FAM190B (2 of 2)

Ensembl ID:
ENSDARG00000091535
Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Human Orthologue:
FAM190B
Human Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Mouse Orthologue:
Gcap14
Mouse Description:
granule cell antiserum positive 14 Gene [Source:MGI Symbol;Acc:MGI:101859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9515 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 115 814 1 11
Genomic Location:
Chromosome 12 (position 14149375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTCCCCTGCTGCTGTAGTTAAATGTAAGAGTGCAGTTTCGACAGCA[C/T]AATGTAGGAGTATAYCACAGCCTACCAAAACCGTTTCCCGCATGACTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v1fe8773