FAM190B (2 of 2)

Ensembl ID:
ENSDARG00000091535
Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Human Orthologue:
FAM190B
Human Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Mouse Orthologue:
Gcap14
Mouse Description:
granule cell antiserum positive 14 Gene [Source:MGI Symbol;Acc:MGI:101859]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27911 Nonsense Mutation detected in F1 DNA During 2016
sa9515 Nonsense Available for shipment Available now
sa41980 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 54 814 1 11
Genomic Location (Zv9):
Chromosome 12 (position 14149557)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13005210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCCCTCCTATGAGTGTAAAGGTGGACCTGTAGGCAGGCAGAATGGTT[T/G]AACACAAGTTCGATCCTTAAACTGGAGAAAGTGTGAAGAGGAAACTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Nonsense 115 814 1 11
Genomic Location (Zv9):
Chromosome 12 (position 14149375)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13005028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTCCCCTGCTGCTGTAGTTAAATGTAAGAGTGCAGTTTCGACAGCA[C/T]AATGTAGGAGTATAYCACAGCCTACCAAAACCGTTTCCCGCATGACTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126866 Essential Splice Site 520 814 3 11
Genomic Location (Zv9):
Chromosome 12 (position 14108581)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12964234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGGGTCCTAGCTGCAATTCTGACTGTCTTTTCACATTTTATTTTATA[A/G]GGACATTCTCAACAAGCTTGAGAATGTGGAGTCATGTGACCTGGAAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link