LOC100331680

Ensembl ID:
ENSDARG00000091499

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30856 Nonsense Mutation detected in F1 DNA During 2015
sa10644 Nonsense Available for shipment Available now
sa14464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127501 Nonsense 97 1002 1 7
Genomic Location:
Chromosome 4 (position 59681737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCTGGGATTGGAAAAACCGTCTCCGTGCAGAAGTTCATTCTGGACTG[G/A]AGTGAAGGAAGAGCCAATCAGGATGTAGATTTCCTGTTTGTGCTTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127501 Nonsense 281 1002 1 7
Genomic Location:
Chromosome 4 (position 59682287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCYGTCTTCTGCTGCATCTCYGCCACMGTTCTTGAAAACATAATYACA[C/T]GAGGTTCMGAAATCCCTCAAAGTCTGACCGAAATGTACATCCACTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127501 Nonsense 872 1002 7 7
Genomic Location:
Chromosome 4 (position 59716843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARRAAAAGCAGTCMTACCCCGATCACCCGGAGAGATTTGACGGCTGGCCA[C/T]AGGTGCTCTGTAGAGAAGGYCTGTCTGGACGCTGCTACTGGGAGGCCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/78hl4q5i