LOC100331680

Ensembl ID:
ENSDARG00000091499

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10644 Nonsense Available for shipment Available now
sa14464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127501 Nonsense 281 1002 1 7
Genomic Location:
Chromosome 4 (position 59682287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCYGTCTTCTGCTGCATCTCYGCCACMGTTCTTGAAAACATAATYACA[C/T]GAGGTTCMGAAATCCCTCAAAGTCTGACCGAAATGTACATCCACTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127501 Nonsense 872 1002 7 7
Genomic Location:
Chromosome 4 (position 59716843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARRAAAAGCAGTCMTACCCCGATCACCCGGAGAGATTTGACGGCTGGCCA[C/T]AGGTGCTCTGTAGAGAAGGYCTGTCTGGACGCTGCTACTGGGAGGCCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/78hl4q5i