LOC799265

Ensembl ID:
ENSDARG00000091498
Human Orthologue:
MFSD11
Human Description:
major facilitator superfamily domain containing 11 [Source:HGNC Symbol;Acc:25458]
Mouse Orthologue:
Mfsd11
Mouse Description:
major facilitator superfamily domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1917150]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33284 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33283 Nonsense Mutation detected in F1 DNA During 2016
sa20107 Essential Splice Site Available for shipment Available now
sa40140 Nonsense Mutation detected in F1 DNA During 2016
sa20106 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125228 Essential Splice Site 50 447 2 13
Genomic Location (Zv9):
Chromosome 3 (position 42646274)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43262731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGAAAAGCTTGAACAGCACTAACTTCACTGGGAGTGGGTATCACAGG[T/G]AAGATTCGCTACATTGTGTGTGCAATATTTAAAGATTTATGAGTGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125228 Nonsense 88 447 4 13
Genomic Location (Zv9):
Chromosome 3 (position 42643220)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43265785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGTTGTCTGTATCCATCACTTCTGCATGTTTTTTTTTTCAGTGGTTA[T/A]ATAGCTGTATTCATCATTCCATCCACATGGTCCTTTTATTTCACATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125228 Essential Splice Site 113 447 4 13
Genomic Location (Zv9):
Chromosome 3 (position 42643145)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43265860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGTCCTTTTATTTCACATCAGTGGTCATTGGCTTTGGGGCAGCCAG[T/C]AAGTACATGTTTAAAACACAAAGCCACATTCATCATGTATTTCATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125228 Nonsense 258 447 10 13
Genomic Location (Zv9):
Chromosome 3 (position 42638828)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43270177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATCTTCATTCCTGCTGTCTCGCTGAAGGTTTGGAGCTGTCGTTTTA[C/A]AGTGGTGTTTATGGGACTTGCATTGGGGCCACAGAATACTTTGGCAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125228 Essential Splice Site 352 447 11 13
Genomic Location (Zv9):
Chromosome 3 (position 42638459)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43270546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGGTTCTACAAACAAGCTCACAGCATAATCCATATCTGGCACCAAG[G/A]TAGACATTTTCAAGACACTCTTATACTTCAGCTGCTGATGTAATTTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link