LOXL2 (2 of 3)

Ensembl ID:
ENSDARG00000091492
Description:
lysyl oxidase-like 2 [Source:HGNC Symbol;Acc:6666]
Human Orthologue:
LOXL2
Human Description:
lysyl oxidase-like 2 [Source:HGNC Symbol;Acc:6666]
Mouse Orthologue:
Loxl2
Mouse Description:
lysyl oxidase-like 2 Gene [Source:MGI Symbol;Acc:MGI:2137913]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34883 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34882 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31777 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127848 Essential Splice Site 262 648 4 12
Genomic Location (Zv9):
Chromosome 10 (position 20457861)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20466644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTCGGAAGCGCCAAAGAGGCTCTCACTGGAGCCAAGTTAGGACAAG[G/A]TTTGTGTGGCTTTTCATGCATGATATGTTTTATCAGTGCTTGTAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127848 Essential Splice Site 314 648 6 12
Genomic Location (Zv9):
Chromosome 10 (position 20453517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCATGAATCGGTATGATTGTGAAACACTGTTTGCTTTTGACTACAAC[A/C]GATACGACTAAGTGGAGGAAGAAACCCATTTGAAGGACGTGTGGAAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127848 Essential Splice Site 314 648 6 12
Genomic Location (Zv9):
Chromosome 10 (position 20453516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCATGAATCGGTATGATTGTGAAACACTGTTTGCTTTTGACTACAACA[G/A]ATACGACTAAGTGGAGGAAGAAACCCATTTGAAGGACGTGTGGAAGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link