ENSDARG00000091482

Ensembl ID:
ENSDARG00000091482
Human Orthologues:
C20orf118, NCOA7, OXR1
Human Descriptions:
chromosome 20 open reading frame 118 [Source:HGNC Symbol;Acc:16112]
nuclear receptor coactivator 7 [Source:HGNC Symbol;Acc:21081]
oxidation resistance 1 [Source:HGNC Symbol;Acc:15822]
Mouse Orthologues:
Gm1332, Ncoa7, Oxr1
Mouse Descriptions:
nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]
oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]
predicted gene 1332 Gene [Source:MGI Symbol;Acc:MGI:2686178]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38216 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32565 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128563 Essential Splice Site 37 160 2 4
Genomic Location (Zv9):
Chromosome Zv9_NA816 (position 10082)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150645.1 10082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGTGCATCTGAACCGCCTTTACTCTCACAGCGTCGTACCTGGACAG[G/A]TGAGATTACCAGAGCTACACTTAAGATCTAATCAAGAGTCAAAATAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128563 Nonsense 131 160 4 4
Genomic Location (Zv9):
Chromosome Zv9_NA816 (position 16830)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150645.1 16830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGACGCCATCACAGGTCCTCATGGATCCCAAAACCCATGGGCCGACCC[A/T]AGATCCGAGCCGGTTCAAGGCCAAAGCTTCGAATTGTGCCTCGGATACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link