foxc1a

Ensembl ID:
ENSDARG00000091481
ZFIN ID:
ZDB-GENE-010302-1
Description:
forkhead box C1a [Source:RefSeq peptide;Acc:NP_571803]
Human Orthologues:
FOXC1, FOXC2
Human Descriptions:
forkhead box C1 [Source:HGNC Symbol;Acc:3800]
forkhead box C2 (MFH-1, mesenchyme forkhead 1) [Source:HGNC Symbol;Acc:3801]
Mouse Orthologues:
Foxc1, Foxc2
Mouse Descriptions:
forkhead box C1 Gene [Source:MGI Symbol;Acc:MGI:1347466]
forkhead box C2 Gene [Source:MGI Symbol;Acc:MGI:1347481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122732 Nonsense 390 476 1 1
Genomic Location:
Chromosome 2 (position 868969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTCGATCACGACYACCACGTCGTCKTTRAGCCACGGGAATCTGAGCT[C/A]GGCCCAGGAGGGCCACCATCCGCACCAAGGGCGCCTCGCCTCATGGTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gxsqiwov