ENSDARG00000091475

Ensembl ID:
ENSDARG00000091475

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33502 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9890 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099663 Essential Splice Site 56 458 3 6
ENSDART00000123549   None 798 None 7
Genomic Location (Zv9):
Chromosome 4 (position 44037415)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 53777396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTGTTTGCCTCTAAATATATTATTACAGTAGTTTTATCTGTTTAC[A/T]GTGATGAATATGAGTCAGCAGATTCAGGAGACGAGACTCTCTGGAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099663   None 458 None 6
ENSDART00000123549 Essential Splice Site 606 798 3 7
Genomic Location (Zv9):
Chromosome 4 (position 44044180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAYACCAGATCAACAATATTCAATCATTWTTGTGTTTGTCCTCTACAC[A/T]GGTTACAGGGCTGTTATCTTACTGTTSRGTCCTGTGAGAGTTTGTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link