ECT2L

Ensembl ID:
ENSDARG00000091471
Description:
epithelial cell transforming sequence 2 oncogene-like [Source:HGNC Symbol;Acc:21118]
Human Orthologue:
ECT2L
Human Description:
epithelial cell transforming sequence 2 oncogene-like [Source:HGNC Symbol;Acc:21118]
Mouse Orthologue:
Ect2l
Mouse Description:
epithelial cell transforming sequence 2 oncogene-like Gene [Source:MGI Symbol;Acc:MGI:3641723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23127 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123093 Essential Splice Site 236 761 6 18
ENSDART00000129416 Essential Splice Site 305 907 8 22
Genomic Location:
Chromosome 17 (position 33606835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTTCCTCACTTTCTACTCGTGTCATCCAAAGTCCCTGGATATGAA[G/A]TAAGACTTGTTCACAACATTCAGTTGCTTCACTTCTTGAATGACAACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42s1d4ee