LOC100148562

Ensembl ID:
ENSDARG00000091465
Human Orthologue:
PLCXD1
Human Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 [Source:HGNC Symbol;Acc:23148]
Mouse Orthologue:
Plcxd1
Mouse Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33900 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130359 Essential Splice Site 228 304 5 6
Genomic Location (Zv9):
Chromosome 6 (position 37400326)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37474084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGCTGATCCAGTATATGGAATGTAAGAAGCAGCTTGGTCGACCTGG[T/C]GAGAGAAGCTTTTAGTTGACCGTTATTGAAAAAACCTATCAGATCTCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link