ENSDARG00000091455

Ensembl ID:
ENSDARG00000091455
Human Orthologues:
CD207, CD209, CLEC4F, CLEC4M, FCER2
Human Descriptions:
C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
CD209 molecule [Source:HGNC Symbol;Acc:1641]
Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
Mouse Orthologues:
Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
Mouse Descriptions:
C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa738 Essential Splice Site Available for shipment Available now
sa27559 Nonsense Mutation detected in F1 DNA During 2015
sa8841 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122010 Essential Splice Site 110 374 1 4
Genomic Location:
Chromosome 10 (position 7530355)
KASP Assay ID:
554-0645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTAATCGCAACAATGACCTGACGAAAGAAAGAGAGCAGATAYTGAAAA[G/A]CAAGAATGACCTTACGAAAGAAAGRGAGCAGATACTAAAAAACAACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122010 Nonsense 183 374 2 4
Genomic Location:
Chromosome 10 (position 7531221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAAAGAGCAGATACTGACACGCAACAATGAGCTGACTAAAGAAAAA[G/T]AGCAGATACTGAAACGTAACAATGACCTGACTAAAGAAAAAGAGCAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122010 Nonsense 370 374 4 4
Genomic Location:
Chromosome 10 (position 7534748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAATAACAATTTATGGGTTGGCTGGAGACAGACAAATGGAGAMAATT[G/A]GATATGGATTGATGACCCTTYWGTGGCAAATGGGTGAGTGATCACCAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1hpwkk1i