FCHSD2 (6 of 6)

Ensembl ID:
ENSDARG00000091428
Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Human Orthologue:
FCHSD2
Human Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Mouse Orthologue:
Fchsd2
Mouse Description:
FCH and double SH3 domains 2 Gene [Source:MGI Symbol;Acc:MGI:2448475]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34955 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130633 Nonsense 307 743 10 24
Genomic Location (Zv9):
Chromosome 10 (position 38093476)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36816414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATTCAGGACAACGCTGTGTTTCAAAAAGCCGCCCCCTTTCAGTAT[C/T]AGCCCGGTGAAAATGATTCGGTAGGTGTCTATTACATATTTTCATATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link