KIAA0802

Ensembl ID:
ENSDARG00000091408
Description:
KIAA0802 [Source:HGNC Symbol;Acc:29121]
Human Orthologue:
KIAA0802
Human Description:
KIAA0802 [Source:HGNC Symbol;Acc:29121]
Mouse Orthologue:
1110012J17Rik
Mouse Description:
RIKEN cDNA 1110012J17 gene Gene [Source:MGI Symbol;Acc:MGI:1915867]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7534 Missense, Splice Site Mutation detected in F1 DNA During 2014
sa19904 Nonsense Mutation detected in F1 DNA During 2014
sa15782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Missense, Splice Site 315 888 3 6
Genomic Location:
Chromosome 2 (position 55037293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRACTWTTWAAACAAGGTAATAACATATGTTTTAACAATGTTTTAWTAG[G/A]TGGCCAAAGATGTATCGGTGCGTCTGCACAATGAACTRGAAACRGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Nonsense 460 888 5 6
Genomic Location:
Chromosome 2 (position 55074710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGACCGGCGGAGGCCCACACACCACACGCGAAGCTGAGCTACGACTA[C/T]GACTTAAACTAGTAGAAGAAGAAGCAAACATCCTGGGGAGGAAGATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Nonsense 495 888 5 6
Genomic Location:
Chromosome 2 (position 55074815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGTTGAAAACCGCGGWCTCAGAGCGGAAAAYGAAGACTTGCGTAGT[C/T]AAKATGAAAGGGATTGCTTTGGCCGTGAACCCTTCTCCAGCGTCCCTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/utlltb1p