KIAA0802

Ensembl ID:
ENSDARG00000091408
Description:
KIAA0802 [Source:HGNC Symbol;Acc:29121]
Human Orthologue:
KIAA0802
Human Description:
KIAA0802 [Source:HGNC Symbol;Acc:29121]
Mouse Orthologue:
1110012J17Rik
Mouse Description:
RIKEN cDNA 1110012J17 gene Gene [Source:MGI Symbol;Acc:MGI:1915867]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7534 Missense, Splice Site Mutation detected in F1 DNA During 2016
sa19904 Nonsense Mutation detected in F1 DNA During 2016
sa15782 Nonsense Available for shipment Available now
sa33057 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Missense, Splice Site 315 888 3 6
Genomic Location (Zv9):
Chromosome 2 (position 55037293)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54720698
KASP Assay ID:
554-4009.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRACTWTTWAAACAAGGTAATAACATATGTTTTAACAATGTTTTAWTAG[G/A]TGGCCAAAGATGTATCGGTGCGTCTGCACAATGAACTRGAAACRGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Nonsense 460 888 5 6
Genomic Location (Zv9):
Chromosome 2 (position 55074710)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54758115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGACCGGCGGAGGCCCACACACCACACGCGAAGCTGAGCTACGACTA[C/T]GACTTAAACTAGTAGAAGAAGAAGCAAACATCCTGGGGAGGAAGATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Nonsense 495 888 5 6
Genomic Location (Zv9):
Chromosome 2 (position 55074815)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54758220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGTTGAAAACCGCGGWCTCAGAGCGGAAAAYGAAGACTTGCGTAGT[C/T]AAKATGAAAGGGATTGCTTTGGCCGTGAACCCTTCTCCAGCGTCCCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130977 Nonsense 796 888 5 6
Genomic Location (Zv9):
Chromosome 2 (position 55075718)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54759123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGACTCCATTAATGCACGCATGAGGACTTTCCGAACCGATCTCCAG[C/T]AATTCATGGATAAAGTGGAGCATCTAGGGGATGGTTTACGGGATCGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link