COL13A1

Ensembl ID:
ENSDARG00000091398
Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Human Orthologue:
COL13A1
Human Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Mouse Orthologue:
Col13a1
Mouse Description:
collagen, type XIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1277201]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7715 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35417 Nonsense Mutation detected in F1 DNA During 2016
sa14592 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Essential Splice Site 86 620 8 42
Genomic Location:
Chromosome 13 (position 7374582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCAAACCTTWNTTTTTCAGGGTGAACCTGGTCCAAAAGGAGAGAAGG[T/G]AAATWATTTATGAAYAATTGTTCTGTAGTTTATRAAACGGTCMAAGAKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 216 620 18 42
Genomic Location:
Chromosome 13 (position 7397100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTTTATTTTCTCGGTTTCTCTTCAGGGAATTAAAGGAGATGAAGGA[C/T]AGAAGGTAAGGAACACATTTGATTATTATTTTGTTGTTGTTGTTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 485 620 35 42
Genomic Location:
Chromosome 13 (position 7433520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGRAACTAATTTGYAACTTTTTGTTTCTYATCAGGGMTCTCCAGGTT[T/A]GTCAGGACCAAAGGTTGGTATTCCTGCCCAAGCCCCTTTTATATTCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link