COL13A1

Ensembl ID:
ENSDARG00000091398
Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Human Orthologue:
COL13A1
Human Description:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
Mouse Orthologue:
Col13a1
Mouse Description:
collagen, type XIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1277201]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35417 Nonsense Mutation detected in F1 DNA During 2016
sa14592 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 216 620 18 42
Genomic Location (Zv9):
Chromosome 13 (position 7397100)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7701710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTTTATTTTCTCGGTTTCTCTTCAGGGAATTAAAGGAGATGAAGGA[C/T]AGAAGGTAAGGAACACATTTGATTATTATTTTGTTGTTGTTGTTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040379 Nonsense 485 620 35 42
Genomic Location (Zv9):
Chromosome 13 (position 7433520)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7738130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGRAACTAATTTGYAACTTTTTGTTTCTYATCAGGGMTCTCCAGGTT[T/A]GTCAGGACCAAAGGTTGGTATTCCTGCCCAAGCCCCTTTTATATTCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link