ENSDARG00000091395

Ensembl ID:
ENSDARG00000091395
Human Orthologues:
CDH10, CDH6, CDH9
Human Descriptions:
cadherin 10, type 2 (T2-cadherin) [Source:HGNC Symbol;Acc:1749]
cadherin 6, type 2, K-cadherin (fetal kidney) [Source:HGNC Symbol;Acc:1765]
cadherin 9, type 2 (T1-cadherin) [Source:HGNC Symbol;Acc:1768]
Mouse Orthologues:
Cdh10, Cdh6, Cdh9
Mouse Descriptions:
cadherin 10 Gene [Source:MGI Symbol;Acc:MGI:107436]
cadherin 6 Gene [Source:MGI Symbol;Acc:MGI:107435]
cadherin 9 Gene [Source:MGI Symbol;Acc:MGI:107433]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14525 Nonsense Available for shipment Available now
sa14677 Essential Splice Site Available for shipment Available now
sa22164 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128298 Nonsense 47 776 1 11
Genomic Location:
Chromosome 12 (position 41246364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGGATCGGGATGGACGGACTCTACACCGCACTAAACGAGGATGGATGT[G/A]GAATAGTTTCTTTCTCTTAGAGGAATGGACAGGAACTGGAAAGCAGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128298 Essential Splice Site 67 776 2 11
Genomic Location:
Chromosome 12 (position 41284762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAATTCKGGAACTGTTAATTCCAGCAAAACTCTCTTTGCTCTTTTTAA[A/G]GCTTCACTCAGACATGGACACGGAAGATGGAAATGTGAAGTACGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128298 Nonsense 624 776 11 11
Genomic Location:
Chromosome 12 (position 41344636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGCCTCTGTCTCCATAGTGATTGTGGTATTGTTTGCGGCCCTGCGG[C/T]GACAAAAGAAAAAGGAGCCCCTGATCATCTCAAAAGAAGACGTTCGCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ugf3wbg5