si:dkey-191j3.2

Ensembl ID:
ENSDARG00000091381
ZFIN ID:
ZDB-GENE-081103-55

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26320 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40312 Nonsense Mutation detected in F1 DNA During 2017
sa25280 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127034   None 773 None 16
ENSDART00000132876 Essential Splice Site 70 698 3 3
Genomic Location (Zv9):
Chromosome 4 (position 29047381)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29752579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGATCTTTACCCCCATACTTTGTGTTGTTGTTCCTGCAGTGTGGAT[A/G]GAGATGATCAGACTGGAGACCTGCAGCAGGATTTACTCCAACCAGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127034   None 773 None 16
ENSDART00000132876 Nonsense 530 698 3 3
Genomic Location (Zv9):
Chromosome 4 (position 29046001)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29753959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTACTGCTTTTTATGTGTTTTACTGCCATTTAACAAAGAAGACAGAA[C/T]AGCTGAAGTTGATTTTTGACACAGAATATTCATATAATCAATATCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127034   None 773 None 16
ENSDART00000132876 Nonsense 598 698 3 3
Genomic Location (Zv9):
Chromosome 4 (position 29045797)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29754163
KASP Assay ID:
554-7432.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCAAGGCCCGAGATTGCTCTGTATGAACTGCTCAGATTGGCAGTAGAT[A/T]AAGCTGTCAGGAGTAGTAATGGTCATCTGGATCTGTTCCTGCGGTTCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link