ENSDARG00000091376

Ensembl ID:
ENSDARG00000091376
Human Orthologue:
ZBTB40
Human Description:
zinc finger and BTB domain containing 40 [Source:HGNC Symbol;Acc:29045]
Mouse Orthologue:
Zbtb40
Mouse Description:
zinc finger and BTB domain containing 40 Gene [Source:MGI Symbol;Acc:MGI:2682254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17792 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127857 Essential Splice Site 338 551 2 3
Genomic Location:
Chromosome 19 (position 11944630)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAYCTCAAAGTTTACCAAGTACAGGAACTCGGCAGAATTCTCAAAAGC[A/T]GACTAGCTCAGAACAGCTMGCGGAAMCTGTACAAASAAATAACAAAGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xe5m3a7f