MYO15A (2 of 3)

Ensembl ID:
ENSDARG00000091370
Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2143 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6910 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112551 Essential Splice Site 7 321 1 9
Genomic Location:
Chromosome 3 (position 40119551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATAACTCCAGTCGATTTGGGAAATATATGGAAATATTTATGGAAGAG[T/A]AAGTTCACCTTCGAGTCAAATCTCTACTGAWTTGTGCACTCATTTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112551 Essential Splice Site 251 321 8 9
Genomic Location:
Chromosome 3 (position 40106188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTACCTTCAGTTCTTTTTCAACAGGGTCATTTTCAAAGAAGAACAAG[T/A]AAGCTGTCTCTGTTCACTCTAATCCTCTGATGAGAGCGATAAAGCCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/szzlj5ft