LOC570574

Ensembl ID:
ENSDARG00000091366
Human Orthologue:
C14orf80
Human Description:
chromosome 14 open reading frame 80 [Source:HGNC Symbol;Acc:20127]
Mouse Orthologue:
4930427A07Rik
Mouse Description:
RIKEN cDNA 4930427A07 gene Gene [Source:MGI Symbol;Acc:MGI:2144738]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32163 Nonsense Available for shipment Available now
sa42971 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124788 Nonsense 172 452 4 8
Genomic Location (Zv9):
Chromosome 17 (position 33906482)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33748213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTAATGGCATGTGGATCAGGTGAGGAACTCACGGTGAAGAAGGAT[C/T]AAGAAATTCAGGCACTGCAGTGGCAATATGGGAAACTAAGACTACAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124788 Essential Splice Site 235 452 6 8
Genomic Location (Zv9):
Chromosome 17 (position 33901060)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33742791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAGCTGCCCTGCGTGTAATTTAGGATTGTTTGTTGCATTTTATTTC[A/C]GGACCTGGAGCGGATTCAAGCGCTGAATGAAATTCTGGAGGCGTATCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link