LOC570574

Ensembl ID:
ENSDARG00000091366
Human Orthologue:
C14orf80
Human Description:
chromosome 14 open reading frame 80 [Source:HGNC Symbol;Acc:20127]
Mouse Orthologue:
4930427A07Rik
Mouse Description:
RIKEN cDNA 4930427A07 gene Gene [Source:MGI Symbol;Acc:MGI:2144738]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45613 Nonsense Mutation detected in F1 DNA During 2018
sa32163 Nonsense Available for shipment Available now
sa42971 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124788 Nonsense 162 452 4 8
Genomic Location (Zv9):
Chromosome 17 (position 33906511)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33748242
GRCz11 17 33700753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCCCCAGGGTCCAATTAGTGGGCTGGATGATCTAATGGCATGTGGAT[C/A]AGGTGAGGAACTCACGGTGAAGAAGGATCAAGAAATTCAGGCACTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124788 Nonsense 172 452 4 8
Genomic Location (Zv9):
Chromosome 17 (position 33906482)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33748213
GRCz11 17 33700724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTAATGGCATGTGGATCAGGTGAGGAACTCACGGTGAAGAAGGAT[C/T]AAGAAATTCAGGCACTGCAGTGGCAATATGGGAAACTAAGACTACAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124788 Essential Splice Site 235 452 6 8
Genomic Location (Zv9):
Chromosome 17 (position 33901060)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33742791
GRCz11 17 33695302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAGCTGCCCTGCGTGTAATTTAGGATTGTTTGTTGCATTTTATTTC[A/C]GGACCTGGAGCGGATTCAAGCGCTGAATGAAATTCTGGAGGCGTATCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link