KIAA1543 (2 of 2)

Ensembl ID:
ENSDARG00000091359
Description:
KIAA1543 [Source:HGNC Symbol;Acc:29307]
Human Orthologue:
KIAA1543
Human Description:
KIAA1543 [Source:HGNC Symbol;Acc:29307]
Mouse Orthologue:
2310057J16Rik
Mouse Description:
RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8735 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39731 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128742 Essential Splice Site 945 1221 12 17
Genomic Location (Zv9):
Chromosome 1 (position 59920009)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58397187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAAGAGCTCAAGAGACGAGCAAGRCAAGGGCAGGACCCTGAGAACAG[G/A]TAAGATCATCTGCACATTCAAATCTTCTCATATWGGACTTRCTTTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128742 Nonsense 1183 1221 17 17
Genomic Location (Zv9):
Chromosome 1 (position 59918805)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58395983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCTCATCAGCTGTGGAAGCCATTTATAAATACAGTTCTGATAGGAAA[C/T]AGTTCAATACACTTCCATCCCGCACTCTGAGCATGAGCGTCGACGCTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link