PAX7 (1 of 3)

Ensembl ID:
ENSDARG00000091353
Description:
paired box 7 [Source:HGNC Symbol;Acc:8621]
Human Orthologue:
PAX7
Human Description:
paired box 7 [Source:HGNC Symbol;Acc:8621]
Mouse Orthologue:
Pax7
Mouse Description:
paired box gene 7 Gene [Source:MGI Symbol;Acc:MGI:97491]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14696 Nonsense Available for shipment Available now
sa41908 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35152 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124068 Nonsense 122 309 2 5
Genomic Location (Zv9):
Chromosome 11 (position 42478275)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40715351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCACCTATCAGCTTCCAGAGTCAACGTATCCCAGCACCACTCTCTCA[C/T]AAGGTAAYGTCTAATAATCAATTMACTTTTATAGTARCAAATCAACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124068 Essential Splice Site 188 309 3 5
Genomic Location (Zv9):
Chromosome 11 (position 42476555)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40717071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTCCAGCAACCACATGAATCCTGTGAGCAACGGCCTCTCGCCACAGG[T/C]TAGTGCCGCGGAGGCCTCTTTCCAATGAAAGAATGATGAAAAGACGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124068 Nonsense 193 309 4 5
Genomic Location (Zv9):
Chromosome 11 (position 42420759)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40772867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCTGAACCTCTGTGTCTGTGTGTCTGTCCGCAGGTGATGAGTATTT[T/A]GAGTAACCCCAGTGCTGTCCCGTCTCAGCCGCAGCATGATTTCTCCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)
  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link