LOC100334628

Ensembl ID:
ENSDARG00000091326
Human Orthologue:
CEP120
Human Description:
centrosomal protein 120kDa [Source:HGNC Symbol;Acc:26690]
Mouse Orthologue:
Cep120
Mouse Description:
centrosomal protein 120 Gene [Source:MGI Symbol;Acc:MGI:2147298]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21164 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122378 Nonsense 461 884 9 17
Genomic Location:
Chromosome 8 (position 108962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACTAAGTAAATGTGTGTGTGTTTTCAGATGTTCCCGATGTGCTCGTA[C/T]GAACTGAAGCTGACGCCGCAGACTCTTCCGTCTCTGTTTCTGCCCCAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zx60d7fo