LOC100006681

Ensembl ID:
ENSDARG00000091322
Mouse Orthologue:
Vwde
Mouse Description:
von Willebrand factor D and EGF domains Gene [Source:MGI Symbol;Acc:MGI:2685313]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15418 Nonsense Available for shipment Available now
sa28497 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa15418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121479 Nonsense 88 847 2 13
Genomic Location:
Chromosome 15 (position 31821568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTCTCTGTCYGATGGAGAGTCTCTGCCAGGCTTTYTAGAGGTGAAG[C/T]AGATGACAGCCTGTGCTACCTGGCAGTTTCTGGGAAGYGGCAGTAAAGAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121479 Nonsense 703 847 12 13
Genomic Location:
Chromosome 15 (position 31838084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCCAATTCCACTCTAGATCTTCTCCAAACCTCCAGGAGTCTGCATA[T/A]AATTTCCCAGAAGACCATTCTTTGTGGGTTTCTCCTGATGCGCTGGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z6zjm3v9