LOC100006681

Ensembl ID:
ENSDARG00000091322
Mouse Orthologue:
Vwde
Mouse Description:
von Willebrand factor D and EGF domains Gene [Source:MGI Symbol;Acc:MGI:2685313]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15418 Nonsense Available for shipment Available now
sa35939 Nonsense Mutation detected in F1 DNA During 2016
sa28497 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121479 Nonsense 88 847 2 13
Genomic Location (Zv9):
Chromosome 15 (position 31821568)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34194979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTCTCTGTCYGATGGAGAGTCTCTGCCAGGCTTTYTAGAGGTGAAG[C/T]AGATGACAGCCTGTGCTACCTGGCAGTTTCTGGGAAGYGGCAGTAAAGAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121479 Nonsense 292 847 7 13
Genomic Location (Zv9):
Chromosome 15 (position 31826679)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34189868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGATGAAGCCACAATCCGTCTTTATTTCGGAAGATGGGAAAGAGTA[T/G]AAACTGACGGTGGAGAGCACTGTGCCTTTACCATGCTCCTTGGAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121479 Nonsense 703 847 12 13
Genomic Location (Zv9):
Chromosome 15 (position 31838084)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34178463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCCAATTCCACTCTAGATCTTCTCCAAACCTCCAGGAGTCTGCATA[T/A]AATTTCCCAGAAGACCATTCTTTGTGGGTTTCTCCTGATGCGCTGGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link