DMXL2 (1 of 3)

Ensembl ID:
ENSDARG00000091293
Description:
Dmx-like 2 [Source:HGNC Symbol;Acc:2938]
Human Orthologue:
DMXL2
Human Description:
Dmx-like 2 [Source:HGNC Symbol;Acc:2938]
Mouse Orthologue:
Dmxl2
Mouse Description:
Dmx-like 2 Gene [Source:MGI Symbol;Acc:MGI:2444630]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23359 Essential Splice Site Available for shipment Available now
sa23358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129387 Essential Splice Site 293 551 8 14
Genomic Location (Zv9):
Chromosome 18 (position 38121606)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39703309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGAACAATGTGAAGAGGATGACGTCCCATCCTATCTATCAGTACTG[T/A]GAGTATTTCTTAGCAGGGACTTTGTAGTTGCCTTTTTATGGGATTAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129387 Nonsense 387 551 11 14
Genomic Location (Zv9):
Chromosome 18 (position 38114137)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39695840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGATTTTGCCTTCATCACGTCCTCTAGTCTGATCGCCACAGCGGGA[C/T]AGTCCAACGATGGCAGGTCAGTTGAATGCTTTATCTTGTCATCACATAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link