PIGR

Ensembl ID:
ENSDARG00000091288
Description:
polymeric immunoglobulin receptor [Source:HGNC Symbol;Acc:8968]
Human Orthologues:
FCAMR, PIGR
Human Descriptions:
Fc receptor, IgA, IgM, high affinity [Source:HGNC Symbol;Acc:24692]
polymeric immunoglobulin receptor [Source:HGNC Symbol;Acc:8968]
Mouse Orthologues:
Fcamr, Pigr
Mouse Descriptions:
Fc receptor, IgA, IgM, high affinity Gene [Source:MGI Symbol;Acc:MGI:1927803]
polymeric immunoglobulin receptor Gene [Source:MGI Symbol;Acc:MGI:103080]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125051 Nonsense 322 399 4 4
Genomic Location (Zv9):
Chromosome 1 (position 58266822)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57166166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAAGTGAAGATCAGCTGTCARATCCCAGAAGAACAGAATAAAAATTA[T/A]TTTTGTAAAGAGGMTGATCATAAGAGCTGCCAGATMAKGAGAGCATCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link