LOC556476

Ensembl ID:
ENSDARG00000091287
Human Orthologue:
EBF3
Human Description:
early B-cell factor 3 [Source:HGNC Symbol;Acc:19087]
Mouse Orthologue:
Ebf3
Mouse Description:
early B-cell factor 3 Gene [Source:MGI Symbol;Acc:MGI:894289]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36382 Nonsense Mutation detected in F1 DNA During 2017
sa28835 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125758 Nonsense 107 543 3 17
Genomic Location (Zv9):
Chromosome 17 (position 20058304)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20208315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGGAACCAGTGAGTGAAAAAACAAACAATGGAATCCATTACAAACTT[C/T]AGTTACTCTACAATAATGGTGAGCACTTTATATATTACCTACGTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125758 Essential Splice Site 437 543 13 17
Genomic Location (Zv9):
Chromosome 17 (position 20053044)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20203055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGTTAAGCTTGAACACAGAGGTTTCCCAGCAGGATGCAGAACGAGG[T/A]ATGCAGAATGTTCAGTGCACGTGAAGATGCTACACGTGCTCCAGTCGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link