si:ch211-225g23.1

Ensembl ID:
ENSDARG00000091271
ZFIN ID:
ZDB-GENE-030131-3256
Human Orthologue:
CENPT
Human Description:
centromere protein T [Source:HGNC Symbol;Acc:25787]
Mouse Orthologue:
Cenpt
Mouse Description:
centromere protein T Gene [Source:MGI Symbol;Acc:MGI:2443939]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13926 Essential Splice Site Available for shipment Available now
sa43579 Nonsense Mutation detected in F1 DNA During 2017
sa7488 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Essential Splice Site 142 891 4 14
ENSDART00000136539 Essential Splice Site 142 914 4 13
ENSDART00000138600 Essential Splice Site 124 146 4 5
Genomic Location (Zv9):
Chromosome 21 (position 6359203)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6297539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGAACSGAATCCAGAGACCAGTGTGTCCAGTGCTGGGGAAAGAACG[T/C]TAGYACCTCTTCATTCCCATGTACCCTCACTAGTTCTATACATGTCGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Nonsense 808 891 12 14
ENSDART00000136539 Nonsense 831 914 11 13
ENSDART00000138600   None 146 None 5
Genomic Location (Zv9):
Chromosome 21 (position 6372210)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6310546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCATCTTCAAGCACTTCGCCAAGACCAAGGTGGCCAGTGACGTCTA[T/A]CCTGTCATTAATGAGATGTAAGAACTTGTGGAAGGATTATTTACATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130651 Missense 818 891 13 14
ENSDART00000136539 Missense 841 914 12 13
ENSDART00000138600   None 146 None 5
Genomic Location (Zv9):
Chromosome 21 (position 6373730)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6312066
KASP Assay ID:
554-4139.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRTCTCCTGCAATGTCNNNNNNTGTTTGTTTTCTSTTTCACTCAGTCTG[T/A]AGAAGWACTTTGACCGGTTGGCTGATGATCTAGAAACATACGCWACTCATGCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link