si:ch73-27e22.8

Ensembl ID:
ENSDARG00000091269
ZFIN IDs:
ZDB-GENE-060503-713, ZDB-GENE-100917-4

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25176 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124583   None 268 None 5
ENSDART00000137146 Essential Splice Site 476 497 6 7
Genomic Location (Zv9):
Chromosome 22 (position 8742838)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8688608
KASP Assay ID:
554-7580.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCATCAACAAAGAACGGACGAGATTCAGGAGATTCAAAGTTGTCAAAG[G/A]TGAGTAGAACTAAATTTATTCAAATAACTCTTTATTTCTGCACAAGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link