LOC566845

Ensembl ID:
ENSDARG00000091260
Human Orthologue:
MYLK4
Human Description:
myosin light chain kinase family, member 4 [Source:HGNC Symbol;Acc:27972]
Mouse Orthologue:
Mylk4
Mouse Description:
myosin light chain kinase family, member 4 Gene [Source:MGI Symbol;Acc:MGI:3643758]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17085 Nonsense Available for shipment Available now
sa32817 Nonsense Mutation detected in F1 DNA During 2016
sa12023 Nonsense Available for shipment Available now
sa39738 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39739 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122138 Nonsense 185 769 2 14
Genomic Location (Zv9):
Chromosome 2 (position 431465)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 398133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGAAGGAACCCAAAGGTTTTCATCTGAGCCTCAAAGGCCTCAAAGCA[C/T]AGAGGAAGAAGAAACCACCAGATTCAGCTGGTAAGTACAAAAACAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122138 Nonsense 276 769 3 14
Genomic Location (Zv9):
Chromosome 2 (position 433163)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 399831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAAGACGAAAGTAGAGAAAAAGGTGACTCTGGATCTCAGAGAAGAA[C/T]AGAAGAACATCCCAGAGACGAACACAGAGGAGATCCGAGAAGAAATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122138 Nonsense 440 769 4 14
Genomic Location (Zv9):
Chromosome 2 (position 434057)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 400725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTAAAGCYGACGGTGTGGAGATCCAGATCGACTTCAGCAAACTGAAG[C/T]AGCAGAGCTTTRAGGATGAAGATGATGAAGATCACGGCGATMACTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122138 Essential Splice Site 675 769 11 14
Genomic Location (Zv9):
Chromosome 2 (position 443654)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 410070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAGAGTAAATGGGTGTGTTTTTCAGTGTGTGTGTTGTGTGTTTTCT[A/G]GGCTCAGCGGTTTGTCGCCGTTCCTCGGGGACGACGATAACGAGACGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122138 Nonsense 699 769 11 14
Genomic Location (Zv9):
Chromosome 2 (position 443728)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 410144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGGGACGACGATAACGAGACGCTGAACAATATTCTGGCCTGTCAGTG[G/A]AACTTCGAGGAGGACGAATTCTCTGAAGTCTCAGCAGAAGCCAAAGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link