LOC100001838

Ensembl ID:
ENSDARG00000091252
Human Orthologue:
SLC22A7
Human Description:
solute carrier family 22 (organic anion transporter), member 7 [Source:HGNC Symbol;Acc:10971]
Mouse Orthologue:
Slc22a7
Mouse Description:
solute carrier family 22 (organic anion transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:18595

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42918 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122190 Nonsense 149 471 4 10
Genomic Location (Zv9):
Chromosome 17 (position 21829569)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21979718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGCATTGAGCACAGAAAGCTGGTCGGGGTGATTGACAGCCTCGCTTG[G/A]ACATTTGGCTTCATGGGCTTCCCTGTGATTGCATACTTCATTCGAGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link