GLT1D1

Ensembl ID:
ENSDARG00000091241
Description:
glycosyltransferase 1 domain containing 1 [Source:HGNC Symbol;Acc:26483]
Human Orthologue:
GLT1D1
Human Description:
glycosyltransferase 1 domain containing 1 [Source:HGNC Symbol;Acc:26483]
Mouse Orthologue:
Glt1d1
Mouse Description:
glycosyltransferase 1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442755]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34451 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129357 Essential Splice Site 126 309 4 13
Genomic Location (Zv9):
Chromosome 8 (position 37390282)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36246429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGGCATTCACTGATGCACTGAAAGAACAGGCTGAGATGCTCCTGG[T/C]AAGACATGTTGTGTTTACCACTGCCATTTCTATCAAATTGTGTTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129357 Nonsense 183 309 8 13
Genomic Location (Zv9):
Chromosome 8 (position 37429223)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36285370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTTTTCTGCTGGTGTGTGGACTCAGACGAGTTAAAGATCCTTTGTA[T/A]CTTGTTGAAGCATTTTCAGGTATTGGTGTTTTGGAAAATCACAGCTCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link