PARD3 (2 of 2)

Ensembl ID:
ENSDARG00000091238
Description:
par-3 partitioning defective 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:16051]
Human Orthologue:
PARD3
Human Description:
par-3 partitioning defective 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:16051]
Mouse Orthologue:
Pard3
Mouse Description:
par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44068 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123770 Nonsense 507 521 10 10
Genomic Location (Zv9):
Chromosome 24 (position 1880696)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1857256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCACCGGTCAGGGACACACACTCCATACTAACCTCAATTCACACTGT[A/T]AAACACACAGACTCTGGAGATCTGGTGCAAGAGCTGGGTGTAGCTAACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link