ENSDARG00000091226

Ensembl ID:
ENSDARG00000091226
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10897 Nonsense Available for shipment Available now
sa8660 Nonsense Available for shipment Available now
sa9604 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129285 Nonsense 199 641 2 2
Genomic Location:
Chromosome 15 (position 30797096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCTTAGATTTTGAAACCARCATGTATTTTCATCTAATAGTTGAAGCC[A/T]GAGACTCAGGAATACCACCTTTTTCTTCATWTGCTGAACTTCATTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129285 Nonsense 287 641 2 2
ENSDART00000129285 Nonsense 287 641 2 2
Genomic Location:
Chromosome 15 (position 30796832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCACATTTAAAATAGAYAAAAATCGAGGCACTCTTTCCACAAYAAAA[C/T]GATTAGACAGAGAACAAATACCATATTAYAATCTCTCCATAAAGGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129285 Nonsense 287 641 2 2
ENSDART00000129285 Nonsense 287 641 2 2
Genomic Location:
Chromosome 15 (position 30796832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCACATTTAAAATAGAYAAAAATCGAGGCACTCTTTCCACAAYAAAA[C/T]GATTAGACAGAGAACAAATACCATATTAYAATCTCTCCATAAAGGCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/677gefkf