DUSP13 (3 of 3)

Ensembl ID:
ENSDARG00000091224
Description:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
Human Orthologue:
DUSP13
Human Description:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
Mouse Orthologue:
Dusp13
Mouse Description:
dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30511 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128138 Nonsense 99 148 2 2
Genomic Location (Zv9):
Chromosome Zv9_NA931 (position 3694)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150355.1 3694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACTGTGCGAGAGGAGTGAGTCGATCCTCCACATTAGTTCTGGCGTA[T/A]CTGATGATCTATGAACATCTCAGCATCGCAGACGCCATCGCTGCCGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link