si:dkey-192p21.6

Ensembl ID:
ENSDARG00000091212
ZFIN ID:
ZDB-GENE-060503-809
Description:
hypothetical protein LOC565246 [Source:RefSeq peptide;Acc:NP_001139059]
Human Orthologue:
HGSNAT
Human Description:
heparan-alpha-glucosaminide N-acetyltransferase [Source:HGNC Symbol;Acc:26527]
Mouse Orthologue:
Hgsnat
Mouse Description:
heparan-alpha-glucosaminide N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1196297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35493 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112547 Essential Splice Site 219 340 6 9
ENSDART00000113390   None 211 None 7
ENSDART00000135383 Essential Splice Site 461 582 15 18
ENSDART00000142404   None 205 None 9
ENSDART00000146487   None 205 None 9
Genomic Location (Zv9):
Chromosome 13 (position 25883133)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25528793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAATAAAGGTATCCTGGCGCGATTCCTGGTTTGGGCTTTAATCCTGG[T/A]ATGTTCACTCAAACACACACCACACACACACACTCAGTTAAAGTTCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link