adh8a

Ensembl ID:
ENSDARG00000091211
ZFIN ID:
ZDB-GENE-030529-3
Description:
alcohol dehydrogenase 8a [Source:RefSeq peptide;Acc:NP_001001946]
Human Orthologues:
ADH1A, ADH1B, ADH4, ADH6, ADH7
Human Descriptions:
alcohol dehydrogenase 1A (class I), alpha polypeptide [Source:HGNC Symbol;Acc:249]
alcohol dehydrogenase 1B (class I), beta polypeptide [Source:HGNC Symbol;Acc:250]
alcohol dehydrogenase 4 (class II), pi polypeptide [Source:HGNC Symbol;Acc:252]
alcohol dehydrogenase 6 (class V) [Source:HGNC Symbol;Acc:255]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide [Source:HGNC Symbol;Acc:256]
Mouse Orthologues:
AC079845.1, Adh1, Adh4, Adh6a, Adh6b, Adh7
Mouse Descriptions:
alcohol dehydrogenase 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:87921]
alcohol dehydrogenase 4 (class II), pi polypeptide Gene [Source:MGI Symbol;Acc:MGI:1349472]
alcohol dehydrogenase 6 (class V), pseudogene 1 (Adh6-ps1), non-coding RNA [Source:RefSeq DNA;Acc:NR
alcohol dehydrogenase 6A (class V) Gene [Source:MGI Symbol;Acc:MGI:1916367]
alcohol dehydrogenase 6B (class V) Gene [Source:MGI Symbol;Acc:MGI:2446626]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene [Source:MGI Symbol;Acc:MGI:87926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14886 Nonsense Available for shipment Available now
sa11223 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008498 Nonsense 60 377 3 9

The following transcripts of ENSDARG00000091211 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 12528311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGGRCTTTGTCACACCGACCTTTACCATCTGGTTGATGGGGACAAG[C/T]GAGGTTTTCCTGTCGTACTGGGACAYGAGAGCGCTGGTGTAGTGGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008498 Essential Splice Site 116 377 4 9

The following transcripts of ENSDARG00000091211 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 12527185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCAAGTTCTGCAAGTGTCCAAAAACAAACCTGTGTGAAAGCAGCTG[G/T]TGAGAAACGAGCAGAAAGCATTACAGCTGACCTCTTATTTTTCATTTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s6zo24oe