ENSDARG00000091207

Ensembl ID:
ENSDARG00000091207
Human Orthologue:
GHSR
Human Description:
growth hormone secretagogue receptor [Source:HGNC Symbol;Acc:4267]
Mouse Orthologue:
Ghsr
Mouse Description:
growth hormone secretagogue receptor Gene [Source:MGI Symbol;Acc:MGI:2441906]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129886 Nonsense 45 335 1 2
Genomic Location:
Chromosome 15 (position 3061659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGATCATCCAGCGCTTTAAGGACATGAAGACCACCACCAACCTGTA[T/A]CTCTCCAGCATGGCCATCTCAGACCTGGTCATCTTCCTCAGCCTGCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5vgv71o6