MAPK8IP1 (2 of 2)

Ensembl ID:
ENSDARG00000091191
Description:
mitogen-activated protein kinase 8 interacting protein 1 [Source:HGNC Symbol;Acc:6882]
Human Orthologue:
MAPK8IP1
Human Description:
mitogen-activated protein kinase 8 interacting protein 1 [Source:HGNC Symbol;Acc:6882]
Mouse Orthologue:
Mapk8ip1
Mouse Description:
mitogen-activated protein kinase 8 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1309464]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44220 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125253 Nonsense 696 696 10 10
Genomic Location (Zv9):
Chromosome 25 (position 4244760)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13707923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAAAGAACATATGGAATATTCCTGTCCGACAGAAGACATCTTCCTC[G/T]AATGACCTTCAGTCTACTTGTATTTTTGCATTATCACACACTATATGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link