si:ch211-241p16.1

Ensembl ID:
ENSDARG00000091169
ZFIN ID:
ZDB-GENE-070705-135
Description:
hypothetical protein LOC568767 [Source:RefSeq peptide;Acc:NP_001119898]
Human Orthologue:
C9orf167
Human Description:
chromosome 9 open reading frame 167 [Source:HGNC Symbol;Acc:25981]
Mouse Orthologue:
A830007P12Rik
Mouse Description:
RIKEN cDNA A830007P12 gene Gene [Source:MGI Symbol;Acc:MGI:2442720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33535 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077245 Nonsense 37 373 1 3
ENSDART00000133814 Nonsense 37 373 2 4
Genomic Location (Zv9):
Chromosome 5 (position 10815654)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9403414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCTATCGCCGCAGCTCAAAGCCATGATCCGCATCAAGAAGAAATA[C/A]CTGAAGAGGACAAACTCAGTCCGACTGGCGAACTCTGGAGTCTCCGACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link