MKI67

Ensembl ID:
ENSDARG00000091150
Description:
antigen identified by monoclonal antibody Ki-67 [Source:HGNC Symbol;Acc:7107]
Human Orthologue:
MKI67
Human Description:
antigen identified by monoclonal antibody Ki-67 [Source:HGNC Symbol;Acc:7107]
Mouse Orthologue:
Mki67
Mouse Description:
antigen identified by monoclonal antibody Ki 67 Gene [Source:MGI Symbol;Acc:MGI:106035]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7688 Nonsense Mutation detected in F1 DNA During 2016
sa31859 Nonsense Mutation detected in F1 DNA During 2016
sa12798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126369 Nonsense 1216 2057 14 15
Genomic Location:
Chromosome 12 (position 11450451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTRAAGTCATTGAAGACCGTTTTTCTTTGAAAGATGAKAAAAACATTSAG[C/T]AGTCTGAAGAAGTGTGCACCTCWRCTAATACCAGYGCAACAGTTGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126369 Nonsense 1331 2057 14 15
Genomic Location:
Chromosome 12 (position 11450106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAAAATCAGCTCGTGGTAGAATTACTAAGCAAAATGATGAAGACCAA[C/T]AAGAAAAGAACATTGAGGCTAGCCAAGTGCCAGCAGATTCCATGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126369 Nonsense 1786 2057 14 15
Genomic Location:
Chromosome 12 (position 11448741)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAAGAGCAAAAGAACCYGAAACAAAGAAAGAAGAAAGTCCCTTRATA[C/T]AGACTAGTTCTGAAATTAATGCAGCAGTTTTGCCACTTGATAAGGTGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link