ENSDARG00000091140

Ensembl ID:
ENSDARG00000091140
Mouse Orthologue:
Pik3r6
Mouse Description:
phosphoinositide-3-kinase, regulatory subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144613]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17122 Nonsense Available for shipment Available now
sa18060 Nonsense Available for shipment Available now
sa40064 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128399 Nonsense 247 738 7 21
Genomic Location:
Chromosome 3 (position 25935971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATYTTAGAGCAGAGAGCAGAAGAYGGAGCTTCAGATGATAACCAGTA[C/A]AAYATAMGGTTACAAGAGATCTACCAAGACATCCTGAGTCCAGCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128399 Nonsense 324 738 9 21
Genomic Location:
Chromosome 3 (position 25939476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCTGCTTACCTGGACCAGGACGATCTAAAGCGTACCTCTRTCATGT[C/A]AACCGTKTCCACAGACAGTGGCATAGAGGGAGACATGYCCATCAGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128399 Essential Splice Site 527 738 12 21
Genomic Location:
Chromosome 3 (position 25943499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACGAGTCAGCCAGCATCCGCTGCATCTTCCCATCTACTCTGTCAAG[G/C]TTAGATTGTGTCACGCATCAATTTTCTTGATTATCTGAGTTTACTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link