ENSDARG00000091140

Ensembl ID:
ENSDARG00000091140
Mouse Orthologue:
Pik3r6
Mouse Description:
phosphoinositide-3-kinase, regulatory subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144613]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17122 Nonsense Available for shipment Available now
sa18060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128399 Nonsense 247 738 7 21
Genomic Location:
Chromosome 3 (position 25935971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATYTTAGAGCAGAGAGCAGAAGAYGGAGCTTCAGATGATAACCAGTA[C/A]AAYATAMGGTTACAAGAGATCTACCAAGACATCCTGAGTCCAGCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128399 Nonsense 324 738 9 21
Genomic Location:
Chromosome 3 (position 25939476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCTGCTTACCTGGACCAGGACGATCTAAAGCGTACCTCTRTCATGT[C/A]AACCGTKTCCACAGACAGTGGCATAGAGGGAGACATGYCCATCAGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y1vtncli