cry2b

Ensembl ID:
ENSDARG00000091131
ZFIN ID:
ZDB-GENE-010426-5
Description:
cryptochrome 2b [Source:RefSeq peptide;Acc:NP_571867]
Human Orthologue:
CRY1
Human Description:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
Mouse Orthologue:
Cry1
Mouse Description:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43736 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125347 Nonsense 590 639 14 15
ENSDART00000128549 Nonsense 453 502 10 11

The following transcripts of ENSDARG00000091131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 787812)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 790724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGCGAACAAATTTTAACATTGACTTAATTTAGGGCGTGTGAGTTG[G/A]CCGAATGTGGGCGGGACTGGAAAAAAAGAAGGGGAGGCTGAGCACAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link