KCNQ2 (2 of 3)

Ensembl ID:
ENSDARG00000091130
Description:
potassium voltage-gated channel, KQT-like subfamily, member 2 [Source:HGNC Symbol;Acc:6296]
Human Orthologue:
KCNQ2
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 2 [Source:HGNC Symbol;Acc:6296]
Mouse Orthologue:
Kcnq2
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 2 Gene [Source:MGI Symbol;Acc:MGI:1309503]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20835 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18417 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130440 Essential Splice Site 93 372 4 5
Genomic Location:
Chromosome 6 (position 58394842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCATCTGATGTGTTTGCTTTACATGTTTGTGTCTTTAATTCACTGTT[A/T]GAGTGGATCAGATTGTCGGTCGAGGGGCTCCAATTACAGACAAGGACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130440 Essential Splice Site 134 372 4 5
Genomic Location:
Chromosome 6 (position 58394968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAGAGGATCCCAGCATGATGGGACGACTCGGGAAAGTGGAGAAACAG[G/A]TGAGAGACWTACAAATGGCAAAGAGCTGTGGAGAAAAGCTCATACGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/252pzpnz