LOC100148888

Ensembl ID:
ENSDARG00000091128
Human Orthologue:
C22orf36
Human Description:
chromosome 22 open reading frame 36 [Source:HGNC Symbol;Acc:33155]
Mouse Orthologue:
AI646023
Mouse Description:
expressed sequence AI646023 Gene [Source:MGI Symbol;Acc:MGI:2143657]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11618 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127073 Nonsense 87 362 1 4
Genomic Location:
Chromosome 10 (position 43033809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGACCCTGCTGAAGGAGCAGAAGCTGGAGCAAGCCATCGATGTGTTG[A/T]AACTGCTTAGAAAGGTACAAAACATCCTTTATTTATCGAGCAGATTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tcujr10k