pkhd1l1

Ensembl ID:
ENSDARG00000091116
ZFIN ID:
ZDB-GENE-060503-475
Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
PKHD1L1
Human Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Mouse Orthologue:
Pkhd1l1
Mouse Description:
polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29197 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18556 Essential Splice Site Available for shipment Available now
sa987 Nonsense Available for shipment Available now
sa29199 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29200 Nonsense Mutation detected in F1 DNA During 2017
sa23516 Nonsense Available for shipment Available now
sa15541 Nonsense Available for shipment Available now
sa39245 Nonsense Mutation detected in F1 DNA During 2017
sa36833 Nonsense Mutation detected in F1 DNA During 2017
sa43277 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23517 Nonsense Available for shipment Available now
sa5923 Nonsense Mutation detected in F1 DNA During 2017
sa17557 Nonsense Available for shipment Available now
sa32243 Essential Splice Site Available for shipment Available now
sa36834 Nonsense Mutation detected in F1 DNA During 2017
sa6556 Nonsense Mutation detected in F1 DNA During 2017
sa15346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Essential Splice Site 451 4196 None 77
ENSDART00000130472   None 3172 None 48

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23346766)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23276181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACCG[T/G]AAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Essential Splice Site 504 4196 None 77
ENSDART00000130472   None 3172 None 48

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23348269)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23277684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAAYAGG[T/C]AAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 678 4196 19 77
ENSDART00000130472   None 3172 None 48

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23349482)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23278897
KASP Assay ID:
554-0891.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCCAGCAGAGATTCCAACCGCTGAGAACAGTAACGTGAAATTTTTC[A/T]GAGATTATGAGATGACCACCACAGGGGTAAGCTGCAAATGCACATGATCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa29199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Essential Splice Site 1433 4196 35 77
ENSDART00000130472 Essential Splice Site 374 3172 8 48
Genomic Location (Zv9):
Chromosome 19 (position 23371866)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23301281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATGATGGCACGACTTTCAGCAGCGGAGACACACAAACTGCCAATGG[T/C]ACAAAACCACAACTTCTTGTCAGTAAACACACAGTTTATTCTAACGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 1660 4196 38 77
ENSDART00000130472 Nonsense 601 3172 11 48
Genomic Location (Zv9):
Chromosome 19 (position 23375776)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23305191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTTCTGGCTTCTTCAGTGGCTCAGTTATGGTAGCGAATGTTCCATGC[A/T]AAGTGGTTTCCTTTGATTATTCTCAAATGGTTTGCGATACTTCCCCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 2124 4196 42 77
ENSDART00000130472 Nonsense 1059 3172 15 48
Genomic Location (Zv9):
Chromosome 19 (position 23379411)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23308826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCATCTGTGTGACCAATGCTGGGCCCAAATCTCAAGAAACTCAAGTG[C/T]GAGTTCAATTGGGGAACAGAGGAATTGCCAGAATGGTAATGTAAAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 2146 4196 43 77
ENSDART00000130472 Nonsense 1081 3172 16 48
Genomic Location (Zv9):
Chromosome 19 (position 23381079)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23310494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAATGTATGTCTCAGGATAATGCTTCCTTCTTCTACATTGACGTCTG[G/A]TCATCTCCCTACACATGGGGTGGTCTCTCTCCTCCTGAGGAGGGATCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 2251 4196 44 77
ENSDART00000130472 Nonsense 1186 3172 17 48
Genomic Location (Zv9):
Chromosome 19 (position 23381483)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23310898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCTCTCAAGAGCTTCCTGTCTATGGCACCAAAACACTGGGAGTCCGA[C/T]AGGGCGTGTTGGATCTGCATGGTATGCAAATTAACATCATTTCTAAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 2862 4196 50 77
ENSDART00000130472 Nonsense 1797 3172 23 48
Genomic Location (Zv9):
Chromosome 19 (position 23389662)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23319077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACCCACACAATGGGCTGGTTGGTAATGTTGCCCACTGGTGAAACATA[C/A]AACTGGTACTTTAATGGTGCATCACAAATCACCAACATCTCATACAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Essential Splice Site 3076 4196 None 77
ENSDART00000130472 Essential Splice Site 2011 3172 None 48
Genomic Location (Zv9):
Chromosome 19 (position 23392176)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23321591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGTTTAATTTTATCCGCAATAAAATCTTCTTATATTTTCACAAAATC[A/G]GGGTGGGCGTCTGATTGCCGGCTGGCCTGATGCACCCTTCAGAGGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 3134 4196 56 77
ENSDART00000130472 Nonsense 2081 3172 29 48
Genomic Location (Zv9):
Chromosome 19 (position 23393534)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23322949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGTGTGTTTGGATCTCTTGACCTGTATGGCATGCCACACAACATCTA[T/A]CACACTAAGCTGGCAAGCACATCCCAGGCAGGAAACAACACTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 3170 4196 57 77
ENSDART00000130472 Nonsense 2117 3172 30 48
Genomic Location (Zv9):
Chromosome 19 (position 23393758)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23323173
KASP Assay ID:
554-3836.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATTATCWTCAGGTTGGGGATAAGATCCTGCTGTCCACCACTAGCTA[T/G]GACCCTTGGCAGACAGAAATMCGCAACATTATTGCTGTTTCCRATTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 3356 4196 61 77
ENSDART00000130472 Nonsense 2303 3172 34 48
Genomic Location (Zv9):
Chromosome 19 (position 23396849)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23326264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGGAGAYAGWAATGTGGTTCGKAGGAACTTGGTTACTTTGACACTGT[G/A]GCCYGGATCTTACAATGGCAGAGCAGAGGAATTTAACTTTCAATGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Essential Splice Site 3497 4196 64 77
ENSDART00000130472 Essential Splice Site 2444 3172 37 48
Genomic Location (Zv9):
Chromosome 19 (position 23397714)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23327129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCCGCGGTCAGTCACAGGTATTCTGACAAAACCGTTCGCGTGCAGG[T/C]GAGAATGCACTACAGTATAAACTGTGCACACTATACAGAAGTGGCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 3803 4196 70 77
ENSDART00000130472 Nonsense 2750 3172 43 48
Genomic Location (Zv9):
Chromosome 19 (position 23400594)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23330009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGTAAATCCTTTGACATCTATTTCACCAGCACAACACCACAGAACT[T/A]AAGACTTATGTTACTGAATGCTGGACCGACAGAGGTTAGTCTAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 3807 4196 70 77
ENSDART00000130472 Nonsense 2754 3172 43 48
Genomic Location (Zv9):
Chromosome 19 (position 23400606)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23330021
KASP Assay ID:
554-4436.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGACATCTATTTCACCAGCACAACACCACAGAACTTAAGACTTATGT[T/A]ACTGAATGCTGGACCGACAGAGGTTAGTCTAGAAGAAGATTTATACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127517 Nonsense 4023 4196 73 77
ENSDART00000130472 Nonsense 2970 3172 46 48
Genomic Location (Zv9):
Chromosome 19 (position 23401807)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23331222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATCCATGGGTATCATTCCTCCTCCACCCTCATCCASTGACCCAGCCT[G/A]GAATAATGTAAGAYGTTAATCYACTTGTTTTATTTGAACAATATATAKCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link