ENSDARG00000091114

Ensembl ID:
ENSDARG00000091114
Human Orthologues:
SPTA1, SPTAN1, SPTBN5
Human Descriptions:
spectrin, alpha, erythrocytic 1 (elliptocytosis 2) [Source:HGNC Symbol;Acc:11272]
spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) [Source:HGNC Symbol;Acc:11273]
spectrin, beta, non-erythrocytic 5 [Source:HGNC Symbol;Acc:15680]
Mouse Orthologues:
Spna1, Spna2, Spnb5
Mouse Descriptions:
spectrin alpha 1 Gene [Source:MGI Symbol;Acc:MGI:98385]
spectrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:98386]
spectrin beta 5 Gene [Source:MGI Symbol;Acc:MGI:2685200]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30513 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130717 Essential Splice Site 78 165 3 6
Genomic Location (Zv9):
Chromosome Zv9_NA454 (position 11696)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150198.1 11696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGGACCATCATCCTCCGCTTCGCCATCCAGGACATCTCAGTGGAAGG[T/G]ATAATTTAACCTTCAGATCACTGTAGCGTTTACAGCAGCAGCAGCCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link