ENSDARG00000091100

Ensembl ID:
ENSDARG00000091100

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17702 Nonsense Available for shipment Available now
sa21865 Nonsense Available for shipment Available now
sa5838 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127595 Nonsense 120 404 2 5
Genomic Location (Zv9):
Chromosome 11 (position 12979696)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12864105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGATTTGKACWATCTCATGGCCGARAGTCRAGAAAGGCTRAGWGTTT[T/A]GAGGCTACAGAYGGAGTCRGAGCGGGAAAGACTAGATGAACTGGAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127595 Nonsense 137 404 2 5
Genomic Location (Zv9):
Chromosome 11 (position 12979746)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12864155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGCTACAGATGGAGTCAGAGCGGGAAAGACTAGATGAACTGGAGAGA[C/T]AGCAGGAGCTCAACAAACAAGACATGGAGTTGCTGAAGGCCCAACTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127595 Essential Splice Site 351 404 4 5
Genomic Location (Zv9):
Chromosome 11 (position 12983368)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12867777
KASP Assay ID:
554-3860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGATGATCCAGAGTTACTTGATAAACTGAATCATGGAGCGAAAGAAG[G/A]TCAGTCTTTTGCAAAGTCTTCCTCACTTTGATCTTCAGATTMTTTTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link