ENSDARG00000091093

Ensembl ID:
ENSDARG00000091093

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35281 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38886 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130327 Essential Splice Site 30 220 1 3
Genomic Location (Zv9):
Chromosome 12 (position 23053120)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21576483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTTACGGCCATACTGCAGCCCAAGTCATCACCTTGTTCCACCTG[G/A]TAAGCAAATGAAGCACTAATTAGCAACATGCACAGTTAAACAATTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130327 Nonsense 186 220 3 3
Genomic Location (Zv9):
Chromosome 12 (position 23057906)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21581269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGGCTGGTTTGAGGGTAGTTTCTCTGTTCAACCAGGAAAAGGACAAT[G/A]GCTAGATGGAGTCATCTGTGACCTCCAGGTCATTTATGAGGACCCAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link