IL1RAP

Ensembl ID:
ENSDARG00000091088
Description:
interleukin 1 receptor accessory protein [Source:HGNC Symbol;Acc:5995]
Human Orthologue:
IL1RAP
Human Description:
interleukin 1 receptor accessory protein [Source:HGNC Symbol;Acc:5995]
Mouse Orthologue:
Il1rap
Mouse Description:
interleukin 1 receptor accessory protein Gene [Source:MGI Symbol;Acc:MGI:104975]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22728 Nonsense Available for shipment Available now
sa22729 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081555 Nonsense 57 308 1 4
Genomic Location (Zv9):
Chromosome 15 (position 44184291)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45338614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGATTTTTCAGCTGATGACCTGCAGAGGGAGTTTAACTGTTCTGCC[A/T]GAAACAGACACGGCTTCAACACCAGCAGAGCACGACTCAAAGCTGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081555 Nonsense 68 308 1 4
Genomic Location (Zv9):
Chromosome 15 (position 44184324)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45338581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTAACTGTTCTGCCAGAAACAGACACGGCTTCAACACCAGCAGAGCA[C/T]GACTCAAAGCTGAACGTAAATACACACACACACTCACTGTCTCTCTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link