LOC566955

Ensembl ID:
ENSDARG00000091086
Human Orthologue:
ALX3
Human Description:
ALX homeobox 3 [Source:HGNC Symbol;Acc:449]
Mouse Orthologue:
Alx3
Mouse Description:
aristaless-like homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:1277097]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8623 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21292 Nonsense Mutation detected in F1 DNA During 2014
sa21291 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126220 Essential Splice Site 242 364 3 4
Genomic Location:
Chromosome 8 (position 25654451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTACATACGATATCTCCCTWCTCCCTCGCTCCGACACATACCAGG[T/C]ACATACACTCAAACACACACACNNTGAACAGAGAAAGCCTTCGTCTAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126220 Nonsense 341 364 4 4
Genomic Location:
Chromosome 8 (position 25652703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGATCCCTTGGGGCCCACACTTTCGAGGCTGGTCCCGAGTCTGAATA[T/G]AAGCCCTCAGGCCTGGTGGCCCTGCGCATGAAAACCAAAGACCCCGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126220 Nonsense 362 364 4 4
Genomic Location:
Chromosome 8 (position 25652640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTGGCCCTGCGCATGAAAACCAAAGACCCCGGAAGCCTGTTATCCTG[G/A]CCAACATGACCGGACGAATGCCACGATTTCACTGAGCCAACAAAAGCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h01oo4h8