LOC100332965

Ensembl ID:
ENSDARG00000091059
Human Orthologue:
ONECUT3
Human Description:
one cut homeobox 3 [Source:HGNC Symbol;Acc:13399]
Mouse Orthologue:
Onecut3
Mouse Description:
one cut domain, family member 3 Gene [Source:MGI Symbol;Acc:MGI:1891409]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10542 Nonsense Available for shipment Available now
sa13190 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129811 Nonsense 381 441 2 2
Genomic Location:
Chromosome 2 (position 58038619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCTGGKGTTCACCGACCTACAGCGCCGAACACTCATCGCCATCTTC[A/T]AGGAGAACAAACGACCCAGCAAGGAGATGCAGATCACCATCTCGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129811 Nonsense 381 441 2 2
Genomic Location:
Chromosome 2 (position 58038619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCTGGKGTTCACCGACCTACAGCGCCGAACACTCATCGCCATCTTC[A/T]AGGAGAACAAACGACCCAGCAAGGAGATGCAGATCACCATCTCGCAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4nfyha7a